A New Theory of Evolution
Tags: Barbara McClintock, Claude Shannon, Darwin, DNA, entropy, Evolution, fossils, genetic code, immune system, James A. Shapiro, linguistic, natural selection, Nobel Prize, punctuated equilibrium, random mutation, random variation, Stephen Jay Gould
Posted in Evolution |
338 Comments

I don’t believe evolution is true no matter how much it’s tweaked. I see nothing unreasonable or self-contradictory about an almighty God creating the universe is a short (six days) span of time.
Should be, “…in a short span of time.”
The thing I find most contradictory about god, is when it gets disappointed, or shocked, angry, experiences regret, or stuff like that. As far as I understand, god by definition, is outside of time. It knows all that was, and all that will be.
Regret: To feel sorry about some past thing, wishing it had not happened, but something else instead.
How can an entity that knows the outcome of all their actions before they commit them – and has the power to do ANYTHING – feel regret?
Because we do things that are regrettable and God gives us the freedom to do them.
Two words: Directed evolution. The end.
Sorry, but I have to say that the “mutation generator” that you set up demonstrates a clear lack of any understanding on your part. This is strange to me, because I believe that you know about DNA and the way that random mutation works, but you are putting your knowledge to the side in order to make an argument that appears convincing at first glance, but falls apart under further inspection. If you made a simulator that used only 4 “letters” which could be turned into 20 different 3 letter “words”, I’m sure you would have a far more accurate result than the current system, which uses every key on the keyboard, potentially combined into every word and non-word in existence. The flaw in your example, is that random mutations STILL CODE FOR AMINO ACIDS, their is no way possible to “destroy the information”.
Derek,
DNA corresponds to the random mutation generator as follows:
4 bit ACGT 2 bit 1/0
64 possible triplets approx. 70 ASCII characters
You can mutate the 1′s and 0′s (“binary”) or you can mutate the letters. Either way you generate garbage.
You can randomly generate any series of amino acids you want but that doesn’t mean that sequence of amino acids will produce any kind of useful protein.
Random mutations definitely destroy information, that’s why the dentist makes you wear a lead apron over your chest when he’s taking x-rays.
Perry
Adenine and thymine bond, as well as guanine and cytosine, this means that there are not as many triplets as you would think since it is not a strictly “4 bit” system like you have stated.
Very few people could design a functioning wing made of biological material, at least with our current technology. I think that it’s somewhat presumptuous to state that any protein sequence randomly generated is “garbage”. Life is like a massive experiment, and if something works, it survives and reproduces, while if something doesn’t work, it dies. I don’t think that any protein is truly worthless, I just think that no one on earth is nearly creative enough to come up with a use for them yet.
Since most mutations are errors of a single letter, it’s also strange to think that the one letter could utterly destroy the piece of evolution. If you think that evolution is being guided by some designer, then how do you explain some of the massive failures i.e. albinoism, dwarfism, mental retardation, etc. All of which are just examples in humanity alone?
Lastly, I think it’s kind of funny when you basically say ” zapping your genitalia with a high powered blast of radiation makes you sterile, therefore random mutations cannot be beneficial.”
I’m just going to assume you were being funny and leave that one alone
Derek,
DNA is indeed a 4 bit system and all combinations of A/C/G/T are equally probable.
You have done nothing to demonstrate that random mutations are beneficial. I challenge you to produce ONE scientific research paper that empirically demonstrates this is the case, rather than merely stating it or assuming it without proof.
Albinoism, dwarfism, mental retardation, etc. are caused by random mutations. This is exactly my point.
I’m not being funny. I’m seriously asking you why you don’t want your genitalia zapped with radiation if you think random mutations may be beneficial.
Perry
I’m not quite understanding what you mean when you say they are all equally probable. They bond into pairs. Are you saying that if the original strand is ATG on top bonded to TAC, that it might mutate into ACG on TAC? Obviously this doesn’t bond together or produce a protein, but I don’t know enough about DNA to say that a mutation like this won’t ever happen.
Aren’t all your assumptions based on the premise that there are good and bad mutations? I’ve been thinking about it, and couldn’t all of the mutations that we classify as bad be useful in SOME situation? I mean, dwarfism could help if food was scarce, albinos might fare better than normal people in an underground environment. I certainly understand that people are used to thinking of things in a linear fashion ( you start uneducated, you want a degree, you go to college, you get the degree.) but I don’t think that anyone has ever come up with a convincing “goal” for all living things in general. If evolution has no clear defined goal, then how can we differentiate a good mutation from a bad one? Couldn’t nearly all mutations be good or bad depending on the environment?
Another problem with your theory is that if a mutation is “good” then it has been designed, but if it is “bad” then it is random. Since this is the only difference, that means that ALL mutations could either be designed or random. If the designed mutations varied in another way other than just being good adaptations for the environment then you could clearly define designed and random, but their doesn’t appear to be any such distinction.
Derek,
If we have a DNA strand ACGGTCGATCGAAATCGGGCTGA
There is no chemical force that prefers any particular order over any other particular order. This neutrality is necessary for DNA to carry instructions at all. It’s just like if your hard drive had a tendency to prefer 1100110011001100110011001100 over any other pattern, you’d have a hard time storing data on it.
99.99999999% of random mutations are bad. Just like 99.9999% of all electrical interference is bad for a signal and 99.9999999% of scratches are bad for a CD. It only takes a few bad genes to make an organism extinct.
The genome actually has error correction mechanisms and redundancy. See James A. Shapiro, “A 21st Century View of Evolution”: http://shapiro.bsd.uchicago.edu/Shapiro.2005.Gene.pdf
The distinction between good and bad can be as simple as what survives. Random mutations kill organisms. There is no known instance where random mutations helped organisms to be more fit, so far as I know.
Okay, that is not what DNA looks like though. That would be what is used in the creation of RNA, or the template that is used in the replication of DNA. The real strand would look like this because it is a double helix, we were just having a misunderstanding because I thought you were talking about a full double helix of DNA
TGC CAG CTA GCT TTA GCC CGA CT
ACG GTC GAT CGA AAT CGG GCT GA
Aside from the fact that whatever possessed this DNA would be retarded because it is missing a base pair at the end, it is a normal double helix of DNA.
First of all, you just pulled those statistics out of thin air. You don’t that what you typed is true, and it’s disingenuous to just make up random statistics to benefit you (although the fact that it’s wrong to do so doesn’t seem to stop anyone from doing it). I would argue in fact that ALL electrical interference is bad for a signal and ALL scratches are bad for CD’s.
I could show you many different instances where mutations benefit organisms, and allow them to be better adapted to their environment. The problem is that you would say these are the product of a designer.
I will try to provide you of an example of a “random mutation” that has benefits if you will provide me with a difference between random mutations and designed mutations because so far, the only way you have differentiated the two is by saying the random mutations are bad, while designed ones are good.
If you define random mutations as bad, then of course they will all be bad, I need some other definition from you to work with.
Derek,
The mutations that drive evolution are induced by cellular genetic engineering, not random corruption of data. See http://www.cosmicfingerprints.com/new-theory-of-evolution/
and James A. Shapiro, “A 21st Century View of Evolution”: http://shapiro.bsd.uchicago.edu/Shapiro.2005.Gene.pdf
I submit to you that if you scour the scientific literature you will not be able to find a single paper that actually demonstrates empirically that random mutations are ever helpful. Why? Exact same reason that all electrical interference is bad for a signal and all scratches are bad for CD’s.
YES there are mutations that are helpful! But they are never random. The only way for a mutation to be helpful is if it follows the rules of grammar in the genetic code. The following article explains that concept a bit more:
http://www.perrymarshall.com/swine-flu-google-ads/
Would you like to know why you are unable to find a single random mutation that benefits an organism? It’s because the way you determine whether a mutation is just “random corruption of data” or if its “cellular engineering of genetic information” is by looking at whether it happens to benefit the organism or not. I challenge you to find a separate mechanism through which random mutations differ from designed ones if you wish to assert that they exist.
Lets say I have a pile of balls and a an open-topped container that is just large enough to accept a single ball some feet away from me. The balls all have the same dimensions, the same color, and are made of the same materials. The balls are all completely identical. I walk up to the can with a ball in my hand, and demonstrate that the ball will just barely fit into the container, but can still make it inside. Now, if I step 10 feet back and but a blind fold on so I can’t see at all, I might say “Wow, it will be very difficult for me to make it into the container with one of these balls, but it is possible.” I might also say ” Wow, this is impossible, I personally could never make it into the container.” Which isn’t true, but is still a fairly valid answer steeped in logic in my opinion and given the circumstances I might agree that it would be very unlikely for anyone to make it into the container.
The answer that I would have an issue with, and that you seem to be providing, is “Wow, this is impossible, I could never make it into the container. Nevertheless, I will continue to try and throw the balls into the container. I am unable to comprehend ever making it into the container by just throwing the ball because it is too difficult. No, if I ever make it into the container, it will be because the ball was divinely engineered to enter the container, and is being driven by the hand of God to enter the container. You can tell the normal balls apart from the divinely engineered ones because the ones that miss are normal and the ones that make it are divinely engineered!”
Do you see the problem here?
Derek,
First of all I can’t discern that you have read Shapiro’s paper. Please read it so we can discuss the facts at hand: http://shapiro.bsd.uchicago.edu/Shapiro.2005.Gene.pdf
Your analogy evades the real nature of the problem. I am asking you to show an actual experiment in which the balls make it into the container. Everyone is *saying* the balls make it in the container but every time I ask them for evidence they evade it.
Furthermore, building a cell is not as simple as throwing balls in a container. Your thought experiment disrespects the complexity of a cell. A cell is more complex than a Pentium chip. Naturalistic theories say that random mutation filtered by natural selection creates structures as complex as Pentium chips. Where is the actual experimental evidence that supports this?
Dobzhansky and Goldschmidt both tried for DECADES to get fruit flies and moths to show some kind of improvement by attempting to accelerate Darwinian evolution with radiation. None of these experiments produced a single positive result.
Popular “Borders bookstore” literature is filled with claims that small random mutations to DNA filtered by natural selection lead to improved progeny. Yet I have challenged people for 5 years to come forward with just one scientific paper that actually demonstrates this – perhaps as Goldschmidt did, or perhaps in some other manner – but I can’t find one. Derek, not one!
Isn’t it frustrating that they can’t find an experiment that supports this assertion?
I am not creating some tautology where every mutation that helps is alleged to be engineered. Nor am I asserting that every one that doesn’t is alleged to be random. I am saying that engineered mutations sometimes work and sometimes do not. But nobody has ever shown that their accidental random mutations were ever helpful. If you read Shapiro’s paper you’ll start to see the problem. I quote Shapiro:
“Major evolutionary steps occur by DNA rearrangements carried out by sophisticated cellular natural genetic engineering systems operating non-randomly.”
“Cellular regulation of natural genetic engineering activities makes evolutionary change responsive to biological inputs with respect to timing and location of DNA rearrangements.”
From http://shapiro.bsd.uchicago.edu/21st_Cent_View_Evol.html
“Natural genetic engineering functions are sensitive to biological inputs, and their non-random operations help explain how novel system architectures can arise in evolution.”
“Non-randomness is evident at three levels: mechanism, timing, and sites of action.”
“These examples make it clear that natural genetic engineering occurs episodically and non-randomly in response to stress events that range from DNA damage to the inability to find a suitable mating partner.”
“Combining this knowledge with our understanding of how natural genetic engineering operates, it is possible to formulate the outlines of a new 21st Century vision of evolutionary engineering that postulates a more regular principle-based process of change than the gradual random walk of 19th and 20th Century theories.”
“In particular, our conceptual formulations are no longer dependent on the operation of stochastic processes. Thus, we can now envision a role for computational inputs and adaptive feedbacks into the evolution of life as a complex system. Indeed, it is possible that we will eventually see such information-processing capabilities as essential to life itself.”
-From J. Biol. Phys. (2002), in press (in the PROCEEDINGS of the 4th International Conference on Biological Physics, Kyoto, Japan, July 30 August 3, 2001) A 21st Century View of evolution by James A. Shapiro
Perry
Thank you for the inciteful teaching. It is really appreciated. I don’t understand why people think that atheism and science are one and the same. When in truth God created everything including science. It’s amazing how the atheist take the darwinian teachings in faith yet reject the bible teachings.
Again thank you.
Shane
Hi Perry,
I posted the following two days ago in another area of your site – but you have not yet responded to the post. Today, I received an invite from your mail service to review this area of discuss – so I have. I again ask you to respond to the following.
Bob
Hi Perry,
I certainly understand your fascination with DNA, this Nucleic acid being one of the two basic building blocks of life. The Amino acids (the other building block), from the simplest structure of glycine (a molecule of five atoms of hydrogen, two atoms of carbon, two atoms of oxygen, and one atom of nitrogen), to the most complex of tryptophan (composed of twelve hydrogen, eleven carbon, two oxygen, and two nitrogen atoms) – along with the Nucleic acids – form the two dozen or so moderately complex molecules that comprise the basic ingredients of all life on Earth.
All current Earthly life is composed of cells – from the single-celled amoeba to the hundred trillion (10 to the power of 14) celled human – serving the basic function of applying energy within open and closed systems. Thus, although on a Cosmic level, Entropy “rules” the Universe from an initial temperature of 10 to the power of 32 at 10 to the power of -43 seconds after the Big Bang (of some 13,700 Million years ago) to a current temperature of about 3 degrees Kelvin – Life on Earth resides within the Open System of our little Solar system. One only needs to spend an entire summer day soaking up the rays of our Sun to appreciate the tremendous power of this energy source impacting an Open System over the past 4,500 Millions years of Earth’s existence.
Naturally, as soon as any discussion includes any element beyond hydrogen and helium, we are also dealing with the Cosmic events of not one, but countless numbers of Super Nova explosions creating all elements having more than two protons within the core of their atoms. Only within the extreme temperatures of these Super Nova extravaganzas do we achieve the fusion of atoms in the range of Uranium 235 and 238 – with explosive distribution of these heavy element debris, floating within gigantic hundred light-year wide clouds from which young stars and solar systems gather their substance.
Of key importance here is the Cosmic evolution dynamic of applied energy on Macro and Micro levels.
After the Earth loses its initial atmosphere of hydrogen, helium, nitrogen, oxygen, neon, carbon, and other trace elements during the first 1,000 Million years of its existence (through “evaporation” from a rather hot Earth into space), the rapidly cooling Earth entraps the remainder of these elements under a crust of rock, explosively out-gassing the pressures through volcanoes, geysers, earthquakes, and the like – releasing vast amounts of gaseous water vapor, carbon dioxide, nitrogen, ash and dust. Further Earth cooling facilitates the liquidization of water vapor into the vast oceans upon the face of the Earth.
Some of the out-gassed carbon dioxide, in the presence of water, forms limestone. Most of the out-gassed oxygen quickly reacts with hydrogen to form more water or mixes with minerals within the crust, forming oxides, such as rust or sand. Breathable oxygen – and the all important protective ozone layer – form only after life, as plants, apply energy to the extraction of carbon from carbon dioxide through the process known as photosynthesis.
During the first 1,000 Million years of the existence of the Earth, the off-gassing of elements into the second atmosphere of the Earth results in the colliding, sticking, and reacting of gasses. Combined with the application of energy from the Sun, radioactivity from radioactive elements within the earth, electromagnetic discharge of energy through lightning, and even sound wave propagation from thunder, breaking chemical bonds – complex gases, such as ammonia and methane, combine into a collection of free atoms and simple molecules. These simple molecules slosh around within the primordial soup creating amino acids and nucleotide bases – in short, organic matter from inorganic substance.
However, prior to the combination of amino acids and nucleotide bases into actual proteins, water molecules must find removal from the ever-lengthening chains of organic matter. There are three primary forces that facilitate the removal of water molecules – heat, cold, and catalytic interaction. Heat, applied along shorelines and within shallow pools, tends to evaporate the water molecules. Cold, in the form of freezing temperatures, forces water, as ice, to leave the primordial soup, concentrating the acids and bases into stronger bonds. Many types of clay along shorelines form the catalytic frameworks for the fabrications of larger organic molecules.
This all happens prior to the formation of proteins and the nucleotide bases of adenine (A), cytosine (C), guanine (G), and thymine (T) found with the molecule of deoxyribonucleic acid (DNA). The fifth nucleotide base, uracil (U), does not reside within the DNA molecule; however, these five nucleotide bases are to the nucleic acids as the twenty amino acids are to the proteins. The Big Twenty-five, so to speak, are the building blocks of life on Earth.
Again, all nucleic acids and proteins are long chain-like arrangements of carbon-rich molecules. Moreover, carbon finds creation through the Cosmic evolution of exploding Super Nova – forging the necessary heat for the fusion of carbon from hydrogen and helium. Thus, it is impossible ever to talk about organic carbon-based organic Life without including a discussion of inorganic Cosmic evolution. In short – Darwin falls short of placing the Evolution of Life within the larger context of Cosmic Evolution.
Thus, Perry, in answer to your question about the so-called “Code of DNA” – the Cosmic Evolution of matter from inorganic matter to organic matter – creates a natural, non-directed, random-event occurring Code, known as DNA! This answers your question of having someone point out just one, naturally occurring code. I provide the answer that you seek. By the by, I am an Atheist.
Bob Allen
Bob,
I don’t see how you have explained the origin of the genetic code – why GGG and GGA code for Glycine for example. GGG and GGA are not Glycine. Where did the rules of the code come from? Basic definitions of information theory: http://www.cosmicfingerprints.com/information-theory-made-simple/
Perry
Hi Perry,
I was getting a tad concerned that you were not going to print my answer to your question. However, I am pleased that you have continued the dialog with me. In the meantime, I have gone to the IIDB/FRDB link that you posted – http://www.freeratio.org//showthread.php?t=135497&page=1 – and have actually reviewed all of the entries on all 52 pages.
By stating that you don’t understand how I explain the origin of DNA and then posing a question about coding triplets – GGG or GGA – I believe that you are getting a little ahead of a number of issues here. So let’s break done some of the issues and look at the details.
The reason that I want to start at what I consider the beginning of things is that I don’t want our conversation to stall over issues of infinite regress and initial starting points. I realize that clarifying initial parameters may take a tad longer at the beginning of the dialog – however, I believe that this clarification will facilitate the ongoing dialog.
You will note that a key time in my initial letter to you is 10 to the power of -43 seconds after the Big Bang (of some 13,700 Million years ago) when the Universe had a temperature of about 10 to the power of 32 degrees. Since then, the Expanding Universe and Entropy has cooled the average temperature to about 3 degrees Kelvin.
I believe that you believe in the Big Bang as something that actually happened about 13,700 Million years ago. Am I correct in understanding this? Am I correct in understanding that you accept the standard model of cosmology and stellar nucleosynthesis? Let’s start with these basics prior to moving on to the origins of DNA.
Bob Allen
Bob,
So far as I know, yes, I accept the big bang and the current cosmology models.
Perry
Dear Bob Allen,
Amino acids are not the second building blocks of life. RNA is that building block and is equally important as DNA, according to many scientists. Hundreds of results stating that RNA is equally important as DNA is avialable on the net. Here is one small snippet from :
http://www.wisegeek.com/what-is-rna.htm
” Many people are familiar with deoxyribonucleic acid (DNA), a nucleic acid which is often referred to as the “building blocks of life” because it contains the genetic material for its parent organism. RNA is equally important, even if it is lesser known, because RNA plays a critical role in helping DNA to copy and express genes, and to transport genetic material around in the cell. RNA also has a number of independent functions which are no less important.
RNA strands have a backbone made from groups of phosphates and ribose, to which four bases can attach. The four bases in RNA are adenine, cytosine, guanine, and uracil. Unlike DNA, RNA consists of a single strand, with strands of RNA folding to compact themselves into the tight space of the cell. Many viruses rely on RNA to carry their genetic material, using their RNA to hijack the DNA of infected cells in order to force those cells to do what the virus wants them to do. . . ”
Regards
VG
Hi Venugopal,
Thanks for joining into the discussion with your comments about the first post above that I made above for Perry. I’ve visited the link that you provide on issues of DBA and RNA; however, I do believe that you do not understand what
I wrote above about the nucleic acids and the amino acids.
As I indicated above – “This all happens prior (removal of water molecules from the ever-lengthening chains of organic matter) to the formation of proteins and the nucleotide bases of adenine (A), cytosine (C), guanine (G), and thymine (T) found with the molecule of deoxyribonucleic acid (DNA). The fifth nucleotide base, uracil (U), does not reside within the DNA molecule; however, these five nucleotide bases are to the nucleic acids as the twenty amino acids are to the proteins. The Big Twenty-five, so to speak, are the building blocks of life on Earth.”
Venugopal, you appear to be talking about the building blocks of DNA and RNA. I am speaking about the building blocks of amino acids, which precede the building of proteins directed by DNA and RNA.
Regards,
Bob Allen
I am a physics student and i consider myself atheist. i have read every word of Mr. perry’s theory. and i dont deny that god exit. i agree he exits and i also agree he made universe and everything. But my question and point of being an atheist is what can HE do now? can he defy his own creation. can he do something that we can call a real miracle? can he makes his presence own? can he stop gravity or make the world more peacfull? or did he really had a choice when he created universe? coz if it would have been any different life wouldnt have exited. If thats the situation, is he really a god?
Acid,
Christian theology has always been emphatic that God had free choice in the kind of universe he wished to create.
It has also been emphatic that the miracles of Christ were evidence of his divinity. Things that would not happen according to the course of purely natural law.
I would encourage you to listen to http://www.cosmicfingerprints.com/audio/newevidence.htm
Perry
Yes, an atheist who admits that God exists. I am sure you aren’t just some wackaloon Creationist. Sure.
I thought, atheist means one who believes that God does not exist !!
REgards
VG
You’re still using fallacies. Like a man looks at a Moon rocket and asks how someone could make it with all those millions of bits relying on each other in just one try. Non-creationists know that thousands of years of learning and inventions went into that Moon rocket, that it evolved from many far simpler forms. So it is with the human being. So it is with our DNA. It’s a deliberate lie to point to human DNA and ask how it can have suddenly appeared fully formed and it would have needed a zillion tries to do so. It didn’t. Only IDiots think that. It had a zillion other simpler forms before it reached the complicated form it is now, starting with very tiny bits of DNA that worked. Something that may help:
http://seqcore.brcf.med.umich.edu/doc/educ/dnapr/sequencing.html
You talk of the protozoa as though it were made yesterday. It wasn’t. It is the “end product” of nearly four billion years of evolution. It bears no resemblance to the far simpler forms living even half a billion years ago. It has had to learn to adapt to literally millions of different environments from too hot to too cold to too salty to too dry to pollution by many different chemicals to all sorts of predators, etc, etc. It is like a modern mobile phone. It may look simple but it has a huge amount of (bio) technology behind it to make it what it is now.
I have already explained how DNA generates new mutations (using recessive DNA). It works thoughout all life. All are a modern form and all could one day change if the need required and time allowed for it.
So we get to the fact that we share 99% of DNA with chimps. We share 50% of DNA with bananas. We share DNA with every living things, whether animal, plant, insect, lizard, fish, fungus, etc. Why is that? And while we are on DNA, dogs came from wolves about 130,000 years ago according to their DNA. How can that be in a world just 6,000 years old?
There are over 30,000,000 different species of insects and according to you, in just 4,316 years, evolving from the few on the ark (surviving on vegetation mats through the flood is trash of the worst kind). Evolution says all avenues would be explored so many different species over such a long time. So where did they all come from. Why did god make literally thousands of each species and sub-species? What point?
But there are many cities continuously inhabited for several thousand years as in pre the flood date:
http://en.wikipedia.org/wiki/List_of_cities_by_time_of_continuous_habitation
I have been to Byblos which has been continually inhabited for 7,000 years. Nearby cities in the Lebanon have been continuously inhabited almost as long. The Egyptian civilisation is 5,000 years old, without a break. Real world: If the flood happened, you could dig down several feet anywhere in the world and find proof. It ain’t there.
This has now become just an appeal to belief. You are comparing computers which we have built over 30 years to DNA which has evolved to it’s present form over literally BILLIONS OF YEARS. Then it’s just making up your own conclusion using incredulity.
Man in his present form has been around for maybe 100,000 years. That is when our DNA reached it’s present form. DNA first appeared maybe FOUR BILLION YEARS AGO. That’s 4,000,000,000 years before modern man and his modern DNA appeared. How many changes can occur in four billion years?
Almost all the creatures of the past appeared in just the last half billion years: Trilobites, fish, insects, lizards, birds, mammals. They all came along after DNA had spent 3,500,000,000 years evolving and changing. And you talk of computers over THIRTY YEARS.
If evolution is true, who needs god? If life can be created from inanimate materials, who needs god? If we can explain how the universe came about, who needs god? The god of the gaps has ever fewer gaps to hide in as we progress.
Jim,
Once again you have only skimmed my articles. It is obvious from what you just said, you are not dealing with any of the fundamental questions I have raised. Happy to continue once you are up to date on my thesis.
I was very much interested in your site when I stumbled across it. I actually saw an ad for you and your site on notorious Atheist, Evillutionist biologist PZ Myers Phyrangula web site.
I was deeply disappointed in what you had to say though. You have nothing new and nothing original. All you are presenting are the same Creationist arguments that have been de-bunked and dismissed many, many times and many, many years ago. You make absolutely no effort to actually present a coherent method for detecting design and you “Code” theory is so incredibly shallow that it takes all of 3 mintes on the web to figure out why it is wrong.
I am really not very happy to see other Christians being so dishonest and shifty. Frankly I think you do more harm than good to Christianity through you celebration of ignorance than you do good.
So, just for my own benefit, do you have any arguments that aren’t already discussed here: http://www.talkorigins.org/indexcc/
Lumpy,
You are going to have to do better than to issue a rant having read precious little of what’s been said here and then giving a link to a website. If you want to discredit my arguments, you will have to participate in this conversation.
Perry
FIne then.
You assert that DNA is a code, with no support whatsoever. You give no reference to any sort of evidence for this and you do not overcome TO’s point that DNA does not follow Zipfs law.
I must have missed the step where you proved that DNA actually is a code, in the same way that Enigma, ROT-13 or ASCII are code, instead of a natural system that falls into a regular repeating pattern. When you are questioned on this, you do not seem provide any sort of support for your assertion aside from saying that it is a code by universal acclaim I think is the phrase you use.
Having done so, you go on to say that since it is a code it must have had an encoder. You seem a bit murky on what the decoder is but I can let that slide.
Of course, if DNA were encoded it would of corse requre an encoder but it is not a code in the sense that you suggest. It is not possible to run my DNA though some system and get me out at the other end. Far from supporting your idea of an Encoder(with a capital E) DNA actually does far better at supporting Evolution. A new trait that occurs in an organism that gives it an advantage is more likely to be passed to subsequent generations via the same DNA in the offspring. Before you even start, even you should be able to admit that your children are not exact copies of yourself and/or your wife. They are slightly different. Maybe a little taller, maybe a little less hair, maybe a bigger nose etc. If you admit that these changes take place, then you already concede Evolution.
That is the argument from Biology. Meanwhile, as a creationist, yours is a mathematical argument. And, as any good matematician knows, sometimes the numbers don’t give you the right answer. Like In numerical methods when you make a bad initial guess, you can get an answer that does not coverge.
Also, the reason that I linked to Talk Origins is that your ideas, far from being new and original, are quite old and have already been refuted long ago. I have indeed read your ideas and your objections to Evolution. In fact I read all of them almost 20 years ago. Now here you are with the same warmed over Creationist tripe trying to pretend that you have come up with something new.
Oh, and I really would like you to refute Michael Shermer’s arguments if possible. If you like I will be glad to send you his book at my own expense.
Does this post meet your lofty requirements to deserve an actual response from you or do you just respond to Creationists pretending to be Atheists?
Lumpy, it could not be more obvious that you have not read the material on my website. This comment does not deserve a response. When you come having done your homework I will be happy to answer your questions. Please read “Information Theory, Evolution and the Origin of Life” by Hubert Yockey (Cambridge University Press, 2005) http://www.amazon.com/gp/product/0521802938?ie=UTF8&tag=httpwwwperryc-20&linkCode=as2&camp=1789&creative=390957&creativeASIN=0521802938
Perry, this is twice now you have not replied to my assertions. Preferring instead to tell me to read a book by Mr.Hubert Yockey. My first questions would be:Are you not capable of defending your own theory? Most people who have “discovered” a “new” theory would at least be able to answer the simple questions and reply to the simple statements that I put forth above. You, however, seem incapable of doing so unless I make a mathematical, rather than a biological, argument.
Indeed, I have done my homework. I am reading Dr. Dawkins new book “The Greatest Show on Earth” right now and I must say, he not only slices and dices your own pet theory but he does a wonderful job of laying out the evidence for Evolution in a clear and crisp manner. Unlike your antique, muddled diatribes.
So, I would encourage you to read his book so that we could discuss it. But, as I have said, I will not be wasting any more time with you. As I feel that attempting to discuss real ideas with fundamentalist dogmatists tends to be a waste of time.
Good luck in your future endeavors and keep in mind that lying is a sin and God will see though clever arguments.
The following quotes are from Richard Dawkins’ book The Blind Watchmaker:
“Every single one of more than a trillion cells in the body contains about a thousand times as much precisely-coded digital information as my entire computer. ”
“Each nucleus, as we shall see in Chapter 5, contains a digitally coded database larger, in information content, than all 30 volumes of the Encyclopaedia Britannica put together. And this figure is for each cell, not all the cells of a body put together.”
Once upon a time there was nothing.
God got bored.
Then there was a “Big Bang” God doesn´t do things on a small scale.
The bang continues today. Reaching further and further out still filling the emptiness that displeased God.
However, on our tiny speck of dust, floating around our tiny sun things seems to have settled down.
God, in His wisdom saw fit to create things in order. The Earth was originally filled with turmoil.Molten rocks flowed as rivers until they cooled and hardened. Became solid sustainable land forms. And during this process many of our precious metals came about, however they were not to be appreciated until much later.
Then God saw fit to create plant life. God knew that at a certain point in the future, mankind (which hadn´t been created yet) would be able to use the fossilized remains of these plants.
Keep in mind, to God, everything is “NOW” and time is not a factor, He “is”.
Well, the Earth continued making its cocktails of oil and water, God even saw fit to toss in a few animals to trim the vegetation because now he was a gardener too.
Well, after all had been well prepared God saw it was adequate for man to occupy. And, because of His divine foresight, everything we needed to get along had been provided in a specific “order”.
Even as we go along today, we are using and preparing the foundations for futre generations as God has foreseen, even though we don´t see or understand the evnts which are happening around us. We simply don´t have the capacity to understand the interlocking nature (Symbiotic relation) of factors which were set into motion by God at some time in the past. Again, keep in mind God occupies the total spectrum of time, so one nanosecond and a million years are the same to Him.
To me, using these simplistic terms, makes it easy to undertand the scheme of things and they make sense, as such, I don´t lose sleep, don´t argue with anyone and can think about other matters.
Hi kids, back again with another “pearl”,
As stated, there seem to have been periods of “mass specie appearances” for no specific reason. It certainly isn´t because we weren´t looking for them. The paleantologists are constantly digging up fossilized remains, and not specifically looking for something from ten thousand years ago or ten million years ago. They find something, study it and draw their conclusions which, we usually take as fact from these gurus of science.
As stated ina previous message, everything came and went at a specific time, by “design” so we could find these things and use them to our advantage, and yes, in some ways abuse them. But think, for just a second- is it just a coincidence that we discovered crude oil at just the right point in time our technology could make use of it? Keeping in mind it has been sitting there, “Fermenting” if you will, for countless thousands, millions of years and this is after the vegetation died, and through the movement of the tectonic plates, compressed, heated at just the right temperature, and time, and Zass! it bubbled up in Pennsylvania one day and originally people sought a way to get rid of this stuff.
Well, much the same can be said for many of the materials we are using today.
There IS A PLAN…it is still being fufilled even as you read this.It´s complicated and far beyond our comprehension, but that´s not what´s important- what is important is that there is a PLAN and we are all included in it unfotunately we are so myopic with our vision we don´t see the fly on the end of our nose.
I have a simple and casual way of looking at life in general, but it all fits and it explains things to my satisfaction.
Back Again folk…
What´s all this about “Evolution”?
#1. Where in the Bible does it say that Adam and Eve were the ONLY humans?
#2. Given the diversity of man, is it not possible God, in his wisdom created people for each major geographical area of the planet? The Americas, Africa, The polar region, Europe etc. So that His creation could flourish?
#3. There have been documented incidents of moths, taken from one geographic zone, to the city. They turned darker, and bascally developed the camoflouge for protection. When the speciaes was returned to the wild they “quickly” reverted to their original colors. This is not evolution-this is called adaptation.
#4. Isn´t it curious that eskimos don´t suffer frostbite as rapidly as the rest of us? But they haven´t grown another toe, finger a third eye or anything else, they have however adapted to their environment (Personally speaking I spent a month in temperatures below 40 below zero-didn´t like it) But you don´t see the eskimos fleeing this environment.
Another curious fact, if there had only been Adam and Eve, what chances for survival would they have had? Unless there had been intervetion, they would have been victims of all the creatures about them- there was divine intervention there to make sure they would survive and propagate.
Life is so simple, why do we try to complicate it by second guessing- the answers are already there for us , we can spend our time doing other things, like watching TV.
1. It doesn’t say that there was only one man, but Eve WAS the first woman, because god created her just for Adam, from his rib.
2. Yeah, but it would’ve been a sausage-fest, with no women around.
3.No, this never happened. There were 2 species of moths, one lighter, the other darker. When the industry nearby made things darker, the lighter species of moth was at a disadvantage because it stuck out, and the predators ate far more of the lighter species which caused the darker species to become more common. This is an example of natural selection, not “adaptation”.
4. Ummm, Eskimos do not have special frostbite immunity. Their bodies probably adjust to the temperature, but that’s human, everyone does that. It wouldn’t feel as cold if you had lived there your whole life, regardless of the color of your skin.
Also, if you’re already running forward with the assumption that Adam and Eve existed, why would you try to convince me there was divine intervention? Doesn’t belief in Adam and Eve necessitate belief in god?
Life is decidedly not simple, as you would know if you’ve ever taken a biology, physics, psychology, civics, or philosophy class, anytime from high school to college. In fact, life is probably one of the most complex things in the universe, and if we never second guessed ourselves, we would never make any progress at all. Perhaps you should spend your time doing other things, like not watching TV.
you have a realy good mind . one must admire ur knowledge
There’s a problem with the “quick brown fox” proof: actually, a few.
First, instead of 26 “letters” in the genetic code, there are only four. Imagine a lexicon with words designed from a four letter alphabet. The chances of a random letter shift generating something recognizable as a different word would be several orders of magnitude higher.
Second, you’re being too literal with this whole “alphabet”/’word”/”sentence” metaphor. A genome is not an essay. DNA is a chain of chemicals. Those basic building blocks follow very different rules than phonetic letters. And the so-called “words” are not being “read” by some language speaker with a microscope: those chemical sequences are resulting in the construction of proteins, or their inhibition. The brain function of decoding a phonetically constructed word is completely different from the physical process of protein building. This is why arguing from metaphor is unscientific.
Third, If a mutation occurs, it doesn’t have to happen on huge numbers of genes simultaneously–those drosophilia mutation experiments simulated enormous numbers of simultaneous errors. That’s going to tend to create massive problems, like feet growing out of mouths. But just one of those errors, within a genome that is otherwise healthy, could potentially result in a mildly different phenotype.
Fourth, DNA doesn’t just create “words” either: different genes operate as activators, inhibitors, etc.. It’s good to keep in mind the rules that go into word creation. Phonemic rules, like the ones that favor consonant-vowel-consonant letter combinations in English, might be analogous to these different “controller” and “activator” gene strands. In other words, they govern the “rules” of the genome’s protein creation. Your quick brown fox experiment might have yielded very different results if you A) narrowed it down to the four letter alphabet lexicon mentioned earlier and B) included in the program certain kinds of letter sorting (such as, “only replace a vowel with a vowel”) that are analogous to some of the meta-rules encoded in DNA strands.
There are other differences between phonetic letters and DNA. Whereas a letter change in a phonetic alphabet leads to something that either is a word in the dictionary or is not, a chemical change in any compound leads to–well, another chemical. It’s like when you add another egg to a cake recipe, or substitute applesauce for butter: it’s still a cake, just different. DNA is less like a blueprint or alphabet, with discrete, traceable construction materials, which either fit together as mass-produced widgets, or fail to, because of flaws in precision engineering. The recipe metaphor is much more apt: you can’t locate “the egg” or “the cup of sugar” in the cake–they pervade throughout. And if, let’s say, you have a mutation that leads to a slightly larger eyeball, that eye won’t be crushed in the procrustean bed of the factory-ordered eye socket; as the body knits together, there is a feed-back mechanism that guarantees a continuity and fluidity of tissue (even in the case of very large mutations in size and shape.) The body is smart enough to make it fit together.
What do you think of these objections?
Glen,
ACGT correspond very closely to 1′s and 0′s.
20 proteins correspond very closely to 26 letters in the alphabet.
Together they form a heirarchy.
This is a very reasonable compraison because DNA contains literal, not figurative, INSTRUCTIONS to assemble proteins into specific structures. No different than a PLC program in a factory contains instructions to put a fender on a car. It is not an metaphor or analogy to say that DNA contains words. A gene is equivalent to a word. There is a reason why linguistic analysis is used extensively in genome research. Just Google “DNA linguistics” and see how many scientific papers come up.
The result of scrambling DNA is no different than the result of scrambling instructions in a machine control program. You can say “Well it will just instruct the machine to make something different.”
Go ahead – try it and see how it works.
Question for you:
If the standard random mutation theory is correct in biology, then why does no one use random mutation to improve computer programs?
HI ,
I have read it all above and i have some thing interesting to share it with you . its about reality ” simulated reality “. Can you mail me regularly
I proposed a new hypothesis for organic change in 1984 with my paper – “Semi-Meiosis as an Evolutionary Mechanism.” Journal of Theoretical Biology 111: 725-735, and several papers since all supporting a planned, determinate evolution incompatible with every aspect of the Darwinian myth. Just as all my anti-Darwinian sources have been ignored so have I. The Darwinians have traditionally pretended that they never had any critics when facts speak exactly the opposite. The Darwinian hoax has been exposed countless times by some of the greatest minds of the post Darwinian era. The Darwinians even ignored Theodosius Dobzhansky and Julian Huxley, both devout Darwnians, when each of them seriously questioned the Darwinian model as I have documented. The mystery is how Huxley and Dobzhansky managed to remain Darwinians themselves!
It has become clear to me that what is really involved here is a congenital deficiency on the part of those who are unable to imagine a purposeful universe. Such is anathema to their mindset.
Mindset is the perfect word to decribe their condition -
mindset or mind-set, noun. “A fixed mental attitude or disposition that predetermines a person’s responses to and and interpretation of situations.”
American Heritage Dictionary.
Quite simply, Darwnians are “born that way” as indicated by the research summarized in William Wright’s seminal book – “Born That Way.” There is absolutely nothing that can be done either for them or with them as they are immune to reason.
“Our actions should be based on the ever-present awareness that human beings in their thinking, feeling, and acting are not free but are just as causally bound as the stars in their motion.”
Albert Einstein
jadavison.wordpress.com
Dominant species theoretically should remain a constant as nature provides and does so quite well in a natural setting but it seems all those dominant species you see in a museum seems to have died out, i’m thinking that some of that change may have occured because of changes in old earths atmosphere that would pioneer any changes that would occur in living things, it seems that the very atmosphere was in a state of change too which may or may not have something to do with the change in us..
Hey guys, let´s wake the world up.Amino acids,microbes, cripes I´ve spent decades studying these little guys, even if they ll got together and had a big party they would produce anything more than some gas. Frankly I cannot see the nonsense that others prepetuate, there is no suchh thing as evolution, thhere only exists “adaptation” which is a whole different issue.
Why are there “mass – extinctions” and they are followed by a whole new species? Is this not a preparation for human kind? Thank God I have an education and I can think for myself. I can clearly see our current situation and our possible destiny. My doctorate hopefully wasn´t wasted on ears who would not listen.
Chuck Linden
I agree. Those who believe that it is intrinsic in the nature of matter to self-assemble into a living evolving creature even once are living in fantasy worlds. If that were true we could be manufacturing life forms on a daily basis from the raw materials of which they are composed. Ontogeny and phylogeny are both total mysteries and those like Richard Dawkins and Paul Zachary Myers who believe otherwise are transparent, deranged, atheist, egomaniacs doomed to intellectual oblivion. There is absolutely nothing in Darwin’s Victorian fancy that had anything to with its title. Darwinism in all its trappings is the most long lived example of mass hysteria in the history of human communication.
I agree that a planned phylogeny had man as its goal and I still maintain that Homo sapiens is the youngest mammal species that will ever appear, probably not more than one hundred thousand years old. It also seems to me that he may have the shortest species tenure on this planet as he continues to do everything in his power to destroy the environment that made his appearance possible.
Now you just watch the hissy fit that the Darwinians here will produce in response to my stated convictions. It is impossible to have a meaningful discussion with a Darwinian just as it is with a Fundamentalist Christian. The truth lies elsewhere in a planned phylogeny which is now in its terminal stages. I believe only extinction remains.
“A past evolution is undeniable, a present evolution undemonstrable.”
http://www.jadavison.wordpress.com
Well, gosh, I have read, written a plethora of books and articles, and All this started at the “Big Bang” and everything was set into motion from that moment, and it will reach its end, but we know not what the “end” will be nor what we will encounter along the way. Don´t worry, God knows and has seen all and knows the “end” even before it gets here. It will get here, we are not privy to when or where, so we shouldn´t be concerned, rest assured it will come we can´t stop it, nor can we slow it down…I think we should take that as a form of comfort. I do.
I have two questions for all you people with your different theories about how everything began.
1. Why are you so uncomfortable with the fact that you don’t know now, nor will you ever know why everything exists?
No matter how adamantly and dogmatically you claim your theory is right, all theories I’ve heard sound ridiculous. The only secularists who claim they have a sound theory as to why everything exists are able to comprehend arcane mathematics that your average Joe couldn’t understand given a life-time of study, so of course those don’t make any sense to me. All of you people who “know” that it was done by some intelligent designer try so hard to make arguments for deism, and then once you feel that your argument for deism is sufficient, you say that your god did it. This is not sound logical reasoning. Religion developed for the sole purpose of unifying large groups of people under the rule of the elite, and served the same function that the constitution of the U.S. does today.
2. Why does it matter who is right or who is wrong?
You do realize that this might just be the least important argument ever to take place on earth, but it has the power to cause groups of people to intensely hate one another? Come on, seriously, is it really that important which magic sky daddy or ridiculously complex and totally impossible to understand cosmological event started it all? People just need to learn to enjoy their lives and be content with the fact that they don’t know what started it all, and the answer to that question will almost certainly not be known for a very, very, long time.